All reagents for cell culture were purchased from Invitrogen/Life Technologies (Carlsbad, CA, USA). Mithramycin A (Mithr.A), pifithrin-alpha (PFT-α), Hoechest dye 33258, H₂O₂ and anti-PUMA antibody were purchased from Sigma-Aldrich (St-Louis, MI, USA). Anti-procaspase 3, 9, 8 antibodies were purchased from Cell Signaling (Beverly, MA). Anti-P53 (DO-1) antibody, anti-Sp1 (polyclonal antibody PEP2) antibody, anti-actin antibody and secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Sp1 siRNA, control siRNA, siRNA Transfection reagent and siRNA Transfection Medium were purchased from Santa Cruz Biotechnology. All other chemicals were of analytical grade.

The -336/+157 and -36/+157 PUMA-Luc reporter plasmids were a kind gift from Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD, U.S.A.). The (-336/+157 -126/-25) PUMA-Luc plasmid was constructed by digesting the -336/+157 PUMA-Luc plasmid with Sac II and SmalI, and re-ligation according to reference 16. pSVβ-Galactosidase plasmid was purchased from promega.

The human colorectal cancer cell lines LoVo and HCT116 were obtained from American Type Culture Collection (Manassaas, VA), LoVo PUMA_AS cells was established as described in a previous study15. The LoVo cells and LoVo PUMA_AS cells were cultured in 25 cm² flasks in 1640 medium contained 10% (v/v) FBS with or without G418 (600 μg/ml). Cells were maintained at 37°C in a humidified 5% CO₂ atmosphere until confluency and subcultured (1:10 split ratio) using trypsin (0.05% w/v)/EDTA (0.02% w/v). Cells for examination were grown in six-well cluster dishes. All treatments were carried out on cells at 70–80% confluence, PFT-α (20 μM) and Mithr.A (200 ng/ml) were added an hour before addition of H₂O₂.

Transient transfection was performed in 6-well plates using Lipofectamin 2000(Invitrogen) according to the manufacture's instructions. Cells were transfected with 0.5 μg luciferase reporter plasmid and 0.1 μg pSVβ, transfections were allowed to proceed for 3 hours in the absence of serum and the cells recovered in medium supplemented with reduced serum level(2.5%) for 21 hours. Luciferase assays were performed 48 hours later using the luciferase assay kit from Promega, according to the manufacture's instructions (Promega, Madison, WI). The β-galactosidase reporter pSVβ (Promega) was included to control for transfection efficiency.

0.5 μg total RNA was isolated from the cells using TRIZOL (Gibco). PUMA mRNA expression was determined by RT-PCR analysis using a RevertAid First Strand cDNA Synthesis Kit (MBI) and PCR kit (SBS Genetech Co. Ltd., Beijing, China). The two gene-specific primers used for amplification were as follows: (upper) gacgacctcaacgcacagta and (lower) ccagggtgtcaggaggtg. PCR products were electrophoresed in 1.5% agarose gel. Beta-actin mRNA was also amplified as an internal control. The experiment was performed twice.

Western blotting analysis was assessed according to the protocol described before15. In brief, cells were washed with ice-cold PBS twice and lysed with ice-cold lysis buffer. Protein samples (15 μg) were separated by SDS/PAGE (12% acrylamide gel) using a Bio-Rad Mini-Protean III system. Proteins were transferred to PVDF membranes and the membranes were blocked for 1 hour at room temperature with TBST. Blots were then incubated at room temperature with primary antibodies (1:500 dilution) and then primary antibodies were removed and the blots were extensively washed with TBS/Tween 20 for three times. Blots were then incubated for 1 hour at room temperature with the secondary antibodies (1: 2000 dilution). Then blots were extensively washed as above for 1 hour and developed using the Enhanced Chemiluminescence detection system and quantified using the GeneTools systems.

siRNA transfection was performed according to the manufacture's instructions. In brief, LoVo cells were seeded at a density of 2 × 10⁵ per well in 2 ml antibiotic-free 1640 medium supplemented with 10% FBS in a six well tissue plate. The cells were incubated at 37°C in a CO₂ incubator until the cells were 70% confluent. siRNA duplex solution (6 μl of siRNA duplex in 100 μl siRNA Transfection Medium) was added directly to the dilute Transfection Reagent (6 μl of siRNA Transfection Reagent in 100 μl siRNA Transfection Medium). The mixture was mixed and incubated at room temperature for 30 minutes. Then the mixture and 0.8 ml siRNA Transfection Medium were mixed and added to the cells. The cells were incubated 6 hours and the mixture was removed. H₂O₂ (0.64 mM) was added 24 hours later and remained for 15 minutes. Western blotting analysis was performed 48 hours post-transfection.

For analysis of apoptosis by nuclear staining with Hoechst dye 33258 (Sigma Chemical Co.), cells were stimulated according to experimental protocols, washed once with PBS, and then fixed with pre-cooled methanol 500 μl/well for 10 minutes. After fixation, cells were washed once with PBS, stained with 1 μM Hoechst dye 33258 for 10 minutes, and then washed once with PBS and distilled water. Apoptosis was indicated by the presence of condensed or fragmented nuclei which bind the Hoechst dye 33258 with high affinity. For analysis of cell structure by photomicroscopy, coverslips were washed once with PBS and then inverted and mounted on to glass slides. Cells were visualized using an Olympus microscope. Two hundred cells in three randomly chosen fields were counted and scored for the incidence of apoptotic chromatin changes under fluorescence microscopy.

All data are presented as mean values ± standard deviation (SD) of three independent experiments. Comparison of the effects of various treatments was performed using factor analysis, one-way ANOVA analysis of variance and a two-tailed t-test. Difference with a p value of < 0.05 were considered statistically significant.

To assess the effects of H₂O₂ on PUMA expression, we exposed LoVo cells to a dose range of H₂O₂ at different time points, and we measured PUMA expression by Western blotting analysis 24 hours later. Exposure to H₂O₂ was found to induce PUMA expression significantly already after 5 minutes. A maximal upregualtion by approximately 50% was observed after 15 minutes (Figure 1A). A dose-range identified that H₂O₂ induced PUMA expression maximally at a concentration of 0.64 mM (Figure 1B).

To assess the effects of H₂O₂ on apoptosis in colorectal cancer, we exposed LoVo cells to a dose range of H₂O₂ at different time points, and we measured apoptosis by Hoechst 33258 dye 24 hours later. As shown in Figure 1C, H₂O₂-induced apoptosis increased significantly at 15 minutes and decreased after 30 minutes. And apoptosis increased significantly when LoVo cells were treated for 15 minutes with 0.64 mM and 0.80 mM of H₂O₂. (Figure 1D).

To investigate whether H₂O₂ increases PUMA expression at the mRNA level, we treated LoVo cells with a dose and time range of H₂O₂ and performed a standard RT-PCR experiment. As seen in Figure 2A and 2B, H₂O₂ increased PUMA mRNA in a dose- and time- dependent manner. Therefore, the data suggested that H₂O₂ up-regulated PUMA expression at transcriptional level.

Activation of p53 by e.g. DNA-damaging agents is followed by an induction of PUMA expression, leading to enhanced recruitment of endogenous p53 protein to the PUMA gene promoter. To test this, we used a -336/+157 PUMA-Luc reporter plasmid, which contains a set of 10 potential binding sites for Sp family proteins in the proximal region between nucleotides-120 and 18, flanked by two p53-recognition sequences at the 5' end between nucleotides -229/-209 and -145/-126. LoVo cells were transfected with this vector, 24 hours before H₂O₂ (0.64 mM) was added. As shown in Figure 2C, a significant transactivation of this promoter was observed after exposure to H₂O₂ for 15 minutes. These results suggest that H₂O₂ can influence endogenous PUMA levels by regulating PUMA promoter activity.

To investigate whether PUMA is required for cells to undergo apoptosis, we made use of LoVo PUMA_AS cells, are stable cell line with low expression of PUMA15. We reasoned that these cells may differentially respond to oxidative stress as compared with their normal counterparts (colorectal cancer LoVo cells). As shown in Figure 3, induction of apoptosis by H₂O₂ is significantly hampered in LoVo PUMA_AS cells, as compared with induction in control LoVo cells (p < 0.05).

The promoter of PUMA gene contains a cluster of GC-rich motifs flanked by two p53-recognition motifs at the 5' end. The p53 sites are located at distal regions relative to the proximal Sp1 sites. The family member Sp1 has been shown to mediate oxidative stress-induced gene transcription. To determine the role of Sp1 in H₂O₂-induced PUMA expression, we examined the activity of a series of PUMA promoter truncation mutants16 after H₂O₂ treatment Compared with cells transfected with -336/+157 PUMA-Luc, the transactivation level of cells transfected with -336/+157 -126/-25PUMA-Luc was lower, but the difference was not significant (p > 0.05). Transfection with the -36/+157PUMA-Luc vector induced a significant decrease of transactivation (^#p < 0.05, Figure 4A).

PFT-α is a stable, water soluble inhibitor of p53-dependent apoptosis and was also shown to reduce the activation of p53-regulated genes 17. Mithramycin A (Mithr.A) is a drug which has been clinically used in the therapies of several type of cancer and Paget's disease. It binds to GC-rich regions in chromatin and interferes with the transcription of genes that bear GC-rich motifs in their promoters including Sp118. Previous study suggested that Mithr.A also activates endogenous p53 protein and has no effect on the expression of endogenous Sp1 genes. To identify the effects of Mithr.A on p53 and Sp1 expression, Mithr.A (200 ng/ml) was added to LoVo cells 24 hours before p53 and Sp1 expression was assessed by Western blotting analysis. As shown in Figure 4B, Mithr.A had no effects on p53 expression, but suppressed the expression of Sp1. Mithr.A also abrogated the Sp1 expression induced by H₂O₂ (Figure 4C). Similarly, PFT-α (20 μM) abrogated p53 expression induced by H₂O_2.

To determine the effects of Mithr.A and PFT-α on PUMA expression, Mithr.A and PFT-α were added an hour before H₂O₂ treatment. As shown in Figure 4D, PUMA expression was found to be suppressed by exposure to Mithr.A as well as to PFT-α, and more markedly when both compounds were combined. To determine whether these effects were cell-specific, we also assessed PUMA expression in HCT116 cells and gained the same results (Figure 4E). To confirm the role of Sp1 in H₂O₂-induced PUMA expression furthermore, we suppressed Sp1 expression by transfecting Sp1 siRNA and our data suggested that Sp1 siRNA abrogated H₂O₂-induced PUMA expression (Figure 4F).

To understand the mechanism of Mithr.A and PFT-α action, we tested the ability of Mithr.A and PFT-α to inhibit PUMA promoter activation induced by H₂O₂. As shown in Figure 4G, Mithr.A caused a decrease in PUMA promoter activity induced by H₂O₂ but the difference was not significant (p < 0.05). PFT-α, in contrast, caused a significant decrease in PUMA expression (p < 140.05). Combination of PFT-α and Mithr.A caused a significant enhancement of decrease in PUMA promoter activity (p < 0.05). Factor analysis (n = 6) indicated that Mithr.A and PFT-α have synergistic effects on H₂O₂-induced PUMA promoter activation (F = 5.480, p = 0.030).

To test whether a decrease in the expression of PUMA contributed to a decrease in the apoptosis of the cells, apoptosis assays were performed. We assessed the impact of Mithr.A and PFT-α treatment on H₂O₂-induced apoptosis in colorectal cancer cells. As shown in Figure 5A, Mithr.A caused a decrease in H₂O₂-induced apoptosis but the difference was not significant with untreated cells, while PFT-α caused a significant decrease. Compared with PFT-α alone, treatment with the combination of both compounds caused a significant decrease in H₂O₂-induced apoptosis.

PUMA is a mitochondrial protein involved in apoptosis in a mitochondrial pathway, leading to activation of caspase 9 and caspase 3 but not caspase 8. To assess the impact of Mithr.A and PFT-α treatment on these events, total cell extracts were prepared from H₂O₂, Mithr.A and PFT-α treated cells, and procaspase 3, procaspase 9 and procaspase 8 levels were monitored by Western blotting analysis. As shown in Figure 5B, increased levels of procaspase 3 and 9 were observed in Mithr.A and PFT-α treated cells, while effects on procaspase 8 were absent.